Sequence retrieval

Genome: Bacillus coagulans 2-6
Start position: 2652162
End position: 2652206
Length: 45

DNA sequence
>NC_015634, from 2652162 to 2652206 (45 bp); Bacillus coagulans 2-6 GTGTTGTTAGCAGTACTGCTGTTGGCAGTAGTGTTATTGGCAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2651247-2652656	Sequence	BCO26_2578 cwlS NLP/P60 protein (Protein is coded in complementary strand; from 2652656 to 2651247)