Sequence retrieval

Genome: Bacillus coagulans 2-6
Start position: 1811346
End position: 1811369
Length: 24

DNA sequence
>NC_015634, from 1811346 to 1811369 (24 bp); Bacillus coagulans 2-6 CCCCCGCCGCCGCCACCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1811289-1812065	Sequence	BCO26_1781 - hypothetical protein (Protein is coded in complementary strand; from 1812065 to 1811289)