Sequence retrieval

Genome: Streptococcus pasteurianus ATCC 43144
Start position: 512734
End position: 512757
Length: 24

DNA sequence
>NC_015600, from 512734 to 512757 (24 bp); Streptococcus pasteurianus ATCC 43144 AAAGCAGAAGCAGAAGCAAAAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 512396-513130	Sequence	SGPB_0490 - polar amino acid transport system ATP-binding protein