Sequence retrieval

Genome: Streptococcus pasteurianus ATCC 43144
Start position: 455649
End position: 455678
Length: 30

DNA sequence
>NC_015600, from 455649 to 455678 (30 bp); Streptococcus pasteurianus ATCC 43144 TTTGATTTTATTTGATGTTGTTTGATTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 455515-456063	Sequence	SGPB_0433 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 456063 to 455515)