Sequence retrieval

Genome: Streptococcus pasteurianus ATCC 43144
Start position: 26407
End position: 26442
Length: 36

DNA sequence
>NC_015600, from 26407 to 26442 (36 bp); Streptococcus pasteurianus ATCC 43144 AAGAAGCAGCTGAACAAGCAGCAGAAGAAGCAGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 25753-27120	Sequence	SGPB_0021 pcsB extracellular peptidoglycan hydrolase