Sequence retrieval

Genome: Streptococcus pasteurianus ATCC 43144
Start position: 2041274
End position: 2041297
Length: 24

DNA sequence
>NC_015600, from 2041274 to 2041297 (24 bp); Streptococcus pasteurianus ATCC 43144 CAAGACCAAGTCCAAAACCAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2040925-2042202	Sequence	SGPB_1970 hisS histidyl-tRNA synthetase (Protein is coded in complementary strand; from 2042202 to 2040925)