Sequence retrieval

Genome: Streptococcus pasteurianus ATCC 43144
Start position: 1017318
End position: 1017341
Length: 24

DNA sequence
>NC_015600, from 1017318 to 1017341 (24 bp); Streptococcus pasteurianus ATCC 43144 CTTTATCTTTGTTTTTATTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1015766-1017364	Sequence	SGPB_0971 - ATP-binding domain-containing protein (Protein is coded in complementary strand; from 1017364 to 1015766)