Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 3062939
End position: 3062974
Length: 36

DNA sequence
>NC_015593, from 3062939 to 3062974 (36 bp); Sphingobium chlorophenolicum L-1 TCGCCATTCTCCGGGCCATTCTCCGGGCCATTCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3061579-3062940	Sequence	Sphch_2896 - wzy family polymerase exosortase system type 1 protein (Protein is coded in complementary strand; from 3062940 to 3061579)