Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 2011914
End position: 2011938
Length: 25

DNA sequence
>NC_015593, from 2011914 to 2011938 (25 bp); Sphingobium chlorophenolicum L-1 CCGCGCCGTGCCGCGCCGCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2010994-2012304	Sequence	Sphch_1894 - hypothetical protein (Protein is coded in complementary strand; from 2012304 to 2010994)