Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 1698241
End position: 1698264
Length: 24

DNA sequence
>NC_015593, from 1698241 to 1698264 (24 bp); Sphingobium chlorophenolicum L-1 CGCGCCCGCGACCGCGCCTGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1697633-1699078	Sequence	Sphch_1581 - cytosol aminopeptidase (Protein is coded in complementary strand; from 1699078 to 1697633)