Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 1499448
End position: 1499471
Length: 24

DNA sequence
>NC_015593, from 1499448 to 1499471 (24 bp); Sphingobium chlorophenolicum L-1 CCGGCGCCAGCGGCGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1498406-1499728	Sequence	Sphch_1384 - integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 1499728 to 1498406)