Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 564197
End position: 564232
Length: 36

DNA sequence
>NC_015593, from 564197 to 564232 (36 bp); Sphingobium chlorophenolicum L-1 GTCGTCGGCGCTGTCGTCCGTGCTGTCGTCGTCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 562461-564506	Sequence	Sphch_0536 - RNA polymerase sigma 70 subunit RpoD (Protein is coded in complementary strand; from 564506 to 562461)