Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 814514
End position: 814540
Length: 27

DNA sequence
>NC_015593, from 814514 to 814540 (27 bp); Sphingobium chlorophenolicum L-1 CGGCATCCCCGGCATCCCCGGCATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 814410-814988	Sequence	Sphch_0754 - polyhydroxyalkonate synthesis repressor PhaR (Protein is coded in complementary strand; from 814988 to 814410)