Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 340890
End position: 340916
Length: 27

DNA sequence
>NC_015593, from 340890 to 340916 (27 bp); Sphingobium chlorophenolicum L-1 CGTTGGCGGCGATGGCGGCGTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 340418-341857	Sequence	Sphch_0338 - D-lactate dehydrogenase (Protein is coded in complementary strand; from 341857 to 340418)