Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 2170113
End position: 2170139
Length: 27

DNA sequence
>NC_015593, from 2170113 to 2170139 (27 bp); Sphingobium chlorophenolicum L-1 GGCGATGGCGGCGATCGCGACGATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2169916-2170164	Sequence	Sphch_2039 - hypothetical protein (Protein is coded in complementary strand; from 2170164 to 2169916)