Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 1584453
End position: 1584479
Length: 27

DNA sequence
>NC_015593, from 1584453 to 1584479 (27 bp); Sphingobium chlorophenolicum L-1 CGCGGTGATCGCGGTGATCGCGGTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1583821-1584582	Sequence	Sphch_1467 - phosphomethylpyrimidine kinase (Protein is coded in complementary strand; from 1584582 to 1583821)