Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 1262716
End position: 1262742
Length: 27

DNA sequence
>NC_015593, from 1262716 to 1262742 (27 bp); Sphingobium chlorophenolicum L-1 GACGGCGATGACGGTGATGGCGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1260935-1262878	Sequence	Sphch_1167 - diguanylate cyclase/phosphodiesterase (Protein is coded in complementary strand; from 1262878 to 1260935)