Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 2987409
End position: 2987432
Length: 24

DNA sequence
>NC_015593, from 2987409 to 2987432 (24 bp); Sphingobium chlorophenolicum L-1 CCGCCACCGCCTTCGCCACCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2987390-2988538	Sequence	Sphch_2813 - beta-lactamase (Protein is coded in complementary strand; from 2988538 to 2987390)