Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 288325
End position: 288348
Length: 24

DNA sequence
>NC_015593, from 288325 to 288348 (24 bp); Sphingobium chlorophenolicum L-1 GCAGCGCCAGCGGCTGCGGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 287166-288560	Sequence	Sphch_0281 - hypothetical protein (Protein is coded in complementary strand; from 288560 to 287166)