Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 2472956
End position: 2472979
Length: 24

DNA sequence
>NC_015593, from 2472956 to 2472979 (24 bp); Sphingobium chlorophenolicum L-1 GCGCCAGCACCAGCACCAGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2472787-2473218	Sequence	Sphch_2308 - GST-like protein (Protein is coded in complementary strand; from 2473218 to 2472787)