Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 2369536
End position: 2369559
Length: 24

DNA sequence
>NC_015593, from 2369536 to 2369559 (24 bp); Sphingobium chlorophenolicum L-1 CGGCATCGTCATAGGCATCGACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2368953-2370011	Sequence	Sphch_2209 - GTP cyclohydrolase-2 (Protein is coded in complementary strand; from 2370011 to 2368953)