Sequence retrieval

Genome: Sphingobium chlorophenolicum L-1
Start position: 1846940
End position: 1846963
Length: 24

DNA sequence
>NC_015593, from 1846940 to 1846963 (24 bp); Sphingobium chlorophenolicum L-1 GCCGCGCCGCCGCGCCGCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1846620-1847378	Sequence	Sphch_1730 - siroheme synthase (Protein is coded in complementary strand; from 1847378 to 1846620)