Sequence retrieval

Genome: Marinomonas posidonica IVIA-Po-181
Start position: 3788391
End position: 3788435
Length: 45

DNA sequence
>NC_015559, from 3788391 to 3788435 (45 bp); Marinomonas posidonica IVIA-Po-181 TTACTTATCGAACCTTTACTTATTGATTCTTTACTTATCAAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3788422-3789141	Sequence	Mar181_3440 - ribonuclease PH (Protein is coded in complementary strand; from 3789141 to 3788422)