Sequence retrieval

Genome: Marinomonas posidonica IVIA-Po-181
Start position: 1822808
End position: 1822834
Length: 27

DNA sequence
>NC_015559, from 1822808 to 1822834 (27 bp); Marinomonas posidonica IVIA-Po-181 TATTGCTCGTATTGCTCTTTTTGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1822256-1823611	Sequence	Mar181_1677 - response regulator receiver protein (Protein is coded in complementary strand; from 1823611 to 1822256)