Sequence retrieval

Genome: Marinomonas posidonica IVIA-Po-181
Start position: 1519622
End position: 1519648
Length: 27

DNA sequence
>NC_015559, from 1519622 to 1519648 (27 bp); Marinomonas posidonica IVIA-Po-181 TTAGGGCTTTTAGGGCTTTTAGGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1518625-1519626	Sequence	Mar181_1410 - Pirin domain-containing protein
ORF... 1519641-1520069	Sequence	Mar181_1411 - GtrA family protein (Protein is coded in complementary strand; from 1520069 to 1519641)