Sequence retrieval

Genome: Acidianus hospitalis W1
Start position: 819717
End position: 819741
Length: 25

DNA sequence
>NC_015518, from 819717 to 819741 (25 bp); Acidianus hospitalis W1 TTTTTTCTTTTTATTTTGTTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 819343-820305	Sequence	Ahos_0898 - putative esterase (Protein is coded in complementary strand; from 820305 to 819343)