Sequence retrieval

Genome: Acidianus hospitalis W1
Start position: 412405
End position: 412428
Length: 24

DNA sequence
>NC_015518, from 412405 to 412428 (24 bp); Acidianus hospitalis W1 AAAAAGAAAAAGATAAAGAGAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 411951-413120	Sequence	Ahos_0416 - hypothetical protein (Protein is coded in complementary strand; from 413120 to 411951)