Sequence retrieval

Genome: Acidianus hospitalis W1
Start position: 207576
End position: 207599
Length: 24

DNA sequence
>NC_015518, from 207576 to 207599 (24 bp); Acidianus hospitalis W1 TATGTAATTATTTAATTATTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 207350-207577	Sequence	Ahos_0206 - VapB-type antitoxin (Protein is coded in complementary strand; from 207577 to 207350)