Sequence retrieval

Genome: Acidianus hospitalis W1
Start position: 1976947
End position: 1976976
Length: 30

DNA sequence
>NC_015518, from 1976947 to 1976976 (30 bp); Acidianus hospitalis W1 TTTTCTTCTTTTTTCAACTTTTTTCTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1976234-1976983	Sequence	Ahos_2174 - Non-specific serine/threonine protein kinase (Protein is coded in complementary strand; from 1976983 to 1976234)