Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 963547
End position: 963576
Length: 30

DNA sequence
>NC_015516, from 963547 to 963576 (30 bp); Melissococcus plutonius ATCC 35311 AAAAAATGATTGAAAATGATAAAAAAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 963532-966060	Sequence	MPTP_0917 - protein export cytoplasm protein SecA ATPase RNA helicase