Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 681463
End position: 681498
Length: 36

DNA sequence
>NC_015516, from 681463 to 681498 (36 bp); Melissococcus plutonius ATCC 35311 TTTTTCTTGTTCTTCTTCTTTTTTCTTTTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 680012-681946	Sequence	MPTP_0655 - PTS system fructose-specific transporter subunit IIABC (Protein is coded in complementary strand; from 681946 to 680012)