Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 55687
End position: 55710
Length: 24

DNA sequence
>NC_015516, from 55687 to 55710 (24 bp); Melissococcus plutonius ATCC 35311 ATTTTTTGATATTTTGAATTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 55365-55730	Sequence	MPTP_0048 - hypothetical protein (Protein is coded in complementary strand; from 55730 to 55365)