Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 37972
End position: 37995
Length: 24

DNA sequence
>NC_015516, from 37972 to 37995 (24 bp); Melissococcus plutonius ATCC 35311 AACAAAGAAATAAAGAAACAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 36617-39262	Sequence	MPTP_0032 - ABC transporter permease (Protein is coded in complementary strand; from 39262 to 36617)