Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 198774
End position: 198827
Length: 54

DNA sequence
>NC_015516, from 198774 to 198827 (54 bp); Melissococcus plutonius ATCC 35311 ATAAACCGAACAAACCAAATGAACCTAATAAACCAAACAAACCAACCAAACCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 198600-199007	Sequence	MPTP_0195 - cell wall surface anchor family protein