Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 1736764
End position: 1736787
Length: 24

DNA sequence
>NC_015516, from 1736764 to 1736787 (24 bp); Melissococcus plutonius ATCC 35311 TCTTTATCTTTATTTTTATCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1736755-1738704	Sequence	MPTP_1686 - CRISPR-associated protein (Protein is coded in complementary strand; from 1738704 to 1736755)