Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 1729374
End position: 1729397
Length: 24

DNA sequence
>NC_015516, from 1729374 to 1729397 (24 bp); Melissococcus plutonius ATCC 35311 CAATAACAAAAACAGTAAAAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1729337-1730116	Sequence	MPTP_1675 - phosphonate ABC transporter permease (Protein is coded in complementary strand; from 1730116 to 1729337)