Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 1716263
End position: 1716298
Length: 36

DNA sequence
>NC_015516, from 1716263 to 1716298 (36 bp); Melissococcus plutonius ATCC 35311 GTCTGGATTAGGCTTTGGATTAGGCTTTGGATTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1715916-1717604	Sequence	MPTP_1663 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 1717604 to 1715916)