Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 1497235
End position: 1497289
Length: 55

DNA sequence
>NC_015516, from 1497235 to 1497289 (55 bp); Melissococcus plutonius ATCC 35311 CTGTTGCGTGACTGTCCCGTGACTGTCCCGTGACTGTCCCGTGACTGTCCCGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1497220-1497690	Sequence	MPTP_1436 - phage replication initiation (Protein is coded in complementary strand; from 1497690 to 1497220)