Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 1259430
End position: 1259456
Length: 27

DNA sequence
>NC_015516, from 1259430 to 1259456 (27 bp); Melissococcus plutonius ATCC 35311 GGCAATGTTGGTAATGTTGGTAATGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1259391-1260170	Sequence	MPTP_1184 - hypothetical protein (Protein is coded in complementary strand; from 1260170 to 1259391)