Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 1115826
End position: 1115849
Length: 24

DNA sequence
>NC_015516, from 1115826 to 1115849 (24 bp); Melissococcus plutonius ATCC 35311 TTTTTTTCTTTTTTTCTTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1115204-1115971	Sequence	MPTP_1052 - peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 1115971 to 1115204)