Sequence retrieval

Genome: Melissococcus plutonius ATCC 35311
Start position: 48004
End position: 48039
Length: 36

DNA sequence
>NC_015516, from 48004 to 48039 (36 bp); Melissococcus plutonius ATCC 35311 ATAAAGAAAAAAATACAGCAAAAAATGAACAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 47962-48801	Sequence	MPTP_0039 - TrmH family tRNA/rRNA methyltransferase YacO