Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 865141
End position: 865194
Length: 54

DNA sequence
>NC_015501, from 865141 to 865194 (54 bp); Porphyromonas asaccharolytica DSM 20707 TGGCTTCTCTTGGTTCTTGGGCTTCTCTTGGTTCTTGGGCTCCTCTAGGTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 865121-866050	Sequence	Poras_0697 - Rod shape-determining protein MreC (Protein is coded in complementary strand; from 866050 to 865121)