Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 813769
End position: 813810
Length: 42

DNA sequence
>NC_015501, from 813769 to 813810 (42 bp); Porphyromonas asaccharolytica DSM 20707 GGTTAGATACTAGAAGTTAGATACTAGAAGTTAGATATTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 813807-814388	Sequence	Poras_0654 - RnfABCDGE type electron transport complex subunit A (Protein is coded in complementary strand; from 814388 to 813807)