Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 780522
End position: 780556
Length: 35

DNA sequence
>NC_015501, from 780522 to 780556 (35 bp); Porphyromonas asaccharolytica DSM 20707 CTCTAATCTCTAACTTCTAATTTCTAATCTCTAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 780553-783240	Sequence	Poras_0629 - calcium-translocating P-type ATPase (Protein is coded in complementary strand; from 783240 to 780553)