Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 395516
End position: 395539
Length: 24

DNA sequence
>NC_015501, from 395516 to 395539 (24 bp); Porphyromonas asaccharolytica DSM 20707 GGAGCAGGAGTAGGAGCGGGAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 394717-395583	Sequence	Poras_0320 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 395583 to 394717)