Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 333279
End position: 333314
Length: 36

DNA sequence
>NC_015501, from 333279 to 333314 (36 bp); Porphyromonas asaccharolytica DSM 20707 GTAAGGCTCTGGGTGAGACTCTGGGTAAGACTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 333088-334341	Sequence	Poras_0273 - Fis family sigma-54 specific transcriptional regulator (Protein is coded in complementary strand; from 334341 to 333088)