Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 260950
End position: 260984
Length: 35

DNA sequence
>NC_015501, from 260950 to 260984 (35 bp); Porphyromonas asaccharolytica DSM 20707 TTAGAGATTAGAAATTAGAGGTTAGAGATTAGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 260979-262919	Sequence	Poras_0217 - peptidase U32 (Protein is coded in complementary strand; from 262919 to 260979)