Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 1706181
End position: 1706246
Length: 66

DNA sequence
>NC_015501, from 1706181 to 1706246 (66 bp); Porphyromonas asaccharolytica DSM 20707 GATATTTTTCATTCTCCACGTGGATATTTTTCATTCTCCACGTGGATATTTTTCATTCTCCACGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1706190-1706408	Sequence	Poras_1321 - hypothetical protein (Protein is coded in complementary strand; from 1706408 to 1706190)