Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 1367343
End position: 1367372
Length: 30

DNA sequence
>NC_015501, from 1367343 to 1367372 (30 bp); Porphyromonas asaccharolytica DSM 20707 GGTGCTGGAGCTGGAGCTGGTGCTGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1367128-1369497	Sequence	Poras_1074 - UvrD/REP helicase (Protein is coded in complementary strand; from 1369497 to 1367128)