Sequence retrieval

Genome: Porphyromonas asaccharolytica DSM 20707
Start position: 1343778
End position: 1343804
Length: 27

DNA sequence
>NC_015501, from 1343778 to 1343804 (27 bp); Porphyromonas asaccharolytica DSM 20707 CTTGCTAGACTTGCTAGACTTGCGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1341661-1344840	Sequence	Poras_1056 - translation initiation factor IF-2 (Protein is coded in complementary strand; from 1344840 to 1341661)